PrimerFinder

What does it do?

The PrimerFinder performs in silico PCR analyses on FASTA files.

PrimerFinder Legacy computes primer binding and amplicon statistics on FASTA formatted files using the now retired ePCR suite of tools from NCBI.

How do I use it?

Subject

In the Subject field, put primer_finder. Spelling counts, but case sensitivity does not.

Description

In the Description field, you must provide:

Required Components

1. analysis=requested_analysis

   • acceptable analyses are custom and vtyper

     • custom analyses require a FASTA-formatted file of primers you wish to use (see Attachments section for additional details)

     • vtyper analyses will use the primer set from the vtyper tool

And AT LEAST ONE of the following:

1. a list of SEQIDs (one per line) - this must be after any other supplied parameters

   • IMPORTANT: You can set optionally inclusivity and exclusivity panels

     • example: inclusivity 2014-SEQ-0276 exclusivity 2025-SEQ-0791 2025-SEQ-0799

   • If you do not specify a panel, it will default to inclusivity -example: 2014-SEQ-0276 2025-SEQ-0791 2025-SEQ-0799

2. A path to a (multi-)FASTA database to use instead of SEQIDs

   • example: database=/path/to/database.fasta
   • the file must be present on the NAS
   • sequences will extracted from the database and saved into individual files with names taken from the FASTA headers
     • e.g. gb|CAJ32491.1|ARO:3002622|aadA6/aadA10 [Pseudomonas aeruginosa] -> gb_CAJ32491_1_ARO_3002622_aadA6_aadA10__Pseudomonas_aeruginosa_
       • Note that the following characters will be substituted for underscores: "/", ".", "|", " ", "[", "]", "(", ")", ":", and "'"

Optional Components

In order to customise your PrimerFinder analyses, several settings can be optionally modified

• Number of mismatches allowed.
  • default is 2
  • options are 0, 1, 2, 3. Anything else will return an error
  • modify as follows:
    • mismatches=1
• Minimum Amplicon size
  • Default is 0 (no minimum size)
  • Maximum is 10000
  • Must be smaller than maximum amplicon size
  • modify as follows:
    • minimum_amplicon_size=150
• Maximum Amplicon size
  • Default is 1500
  • Maximum is 10000
  • Must be larger than minimum amplicon size
  • modify as follows:
    • maximum_amplicon_size=1750
• Contig breaks
  • If ipcress cannot find an amplicon, search the genome for the primers and return a positive result if they are found on separate contigs
  • default is False
  • modify as follows:
    • contig_breaks=True
• Probe
  • Probe sequence to be searched against amplicons generated from primer pairs
  • this can be supplied more than once
  • modify as follows:
    • probe=CGCGTTATCATCACTGTTACCGATAGCG

Attachments

For custom analyses, you are required to attach a FASTA-formatted file containing the primer set(s) you wish analysed. The file must have the following format:

>gene1-F
seq
>gene1-R
seq
>gene2-F1
seq
>gene2-R1
seq
>gene2-F2
seq
>gene2-R2
seq
.....

You are allowed to use IUPAC degenerate bases in this file. Ipcress (the program that runs the in silico PCR reactions) seems to have the limitation of being able to acceept degenerate bases, but not handling them properly e.g. if there are degenerate bases in a sequence, no matter the number they will count as a single mismatch (even if they shoud return a match e.g. an R should be a match if the query sequence is an 'A' or a 'G'). Therefore, if you actually want to a maximum of two mismatches in a primer pair that contains one or more degenerate bases, you must specify the number of mismatches to be three.

# Dictionary of degenerate IUPAC codes
iupac = {
    'R': ['A', 'G'],
    'Y': ['C', 'T'],
    'S': ['C', 'G'],
    'W': ['A', 'T'],
    'K': ['G', 'T'],
    'M': ['A', 'C'],
    'B': ['C', 'G', 'T'],
    'D': ['A', 'G', 'T'],
    'H': ['A', 'C', 'T'],
    'V': ['A', 'C', 'G'],
    'N': ['A', 'C', 'G', 'T'],
    '-': ['-']
}

Examples

Example PrimerFinder analyses:

vtyper analyses issue 37405

custom analyses issue 37407

vtyper analyses, no inclusivity/exclusivity defined, custom mismatches issue 37408

custom analyses with probe issue 37409

custom analysis with database option Issue 37415

How long does it take?

PrimerFinder is very fast (seconds per sample)

What can go wrong?

1. Requested SEQIDs are not available.
2. Not including the program=requested_program component, or requesting an unsupported program
3. Not including the analysis=requested_analysis component, or requesting an unsupported analysis
4. Specifying an unsupported number of mismatches
5. Incorrectly formatted kmersize
6. Providing a minimum_amplicon_size and/or maximum_amplicon_size with a value that is either too large or to small
7. Attaching an incorrectly formatted primer file, or not including a primer file for custom analyses
8. ?

If anything goes wrong, an error message explaining the error should be returned.